Overview¶
Anneal pH Trigger Duplex hybridizes the pH-responsive strand (pH-responsive-ssDNA-2) and the trigger strand (trigger-ssDNA-3) in IDT duplex buffer. Each strand is dissolved to 100 µM in IDT duplex buffer, and the two stocks are mixed at a 3:1 volume ratio (pH-responsive : trigger), giving 75 µM pH-responsive strand and 25 µM trigger strand before annealing. An earlier design target called for 14.4 µM pH-responsive strand and 4.8 µM trigger strand (Module Development Plan: DevCell-based pH sensor); the executed protocol used the higher concentrations given here. The duplex is the sensing element of the pH-Sensing Detector, which the pH Sensing Cell carries: acidification releases the trigger strand, which activates a toehold switch RNA (Hwang et al., 2025). The cooling program runs from 95 °C to 25 °C in about 7 h. The pH Sensing Cell uses the annealed duplex at a stock concentration of 25 µM. This is the concentration of the trigger strand.
Genetically Encoded Components
The two oligonucleotides. Each is a single strand.
| Name | Length (nt) | Sequence (5′ to 3′) | File |
|---|---|---|---|
pH-responsive-ssDNA-2 | 49 | TTCTCTTCTCGTTTGCTCTTCTCTTGTGTGGTATTGTCCAAGAGAAGAG | pH |
trigger-ssDNA-3 | 36 | TATGCAAACAAGACAATACCACACAATTTTTTTTTT | trigger-ssDNA-3.gb |
Materials and Equipment¶
Bill of Materials
| Name | Category | Product | Manufacturer | Part # | Price | Storage | Link |
|---|---|---|---|---|---|---|---|
| IDT duplex buffer | Reagent | Nuclease Free Duplex Buffer (10 x 2 mL) | IDT | 11-01-03-01 | $17.00 | -20 °C | link |
The two oligonucleotides, a thermocycler, and nuclease-free tubes are also required.
Protocol¶
Anneal the Strands¶
Combine the strands in IDT duplex buffer.
Dissolve
pH-responsive-ssDNA-2andtrigger-ssDNA-3separately to 100 µM each in IDT duplex buffer.Mix the two stocks at a 3:1 volume ratio (pH-responsive : trigger). This gives 75 µM pH-responsive strand and 25 µM trigger strand.
Anneal in a thermocycler. Cool in steps of 1 °C, with this program:
Annealing program. Tm is the melting temperature of the duplex, 52 °C.
| Stage | From | To | Time per °C |
|---|---|---|---|
| Denature | 95 °C | 95 °C | 5 min hold |
| Cool to Tm | 95 °C | 52 °C (Tm) | 2 min |
| Slow cool | 52 °C (Tm) | 42 °C (Tm − 10 °C) | 30 min |
| Cool to room temperature | 42 °C | 25 °C | 2 min |
Store the annealed duplex at −20 °C.
Credits¶
Developed by Sung-Won Hwang, Samuel Chen and Allen P. Liu (University of Michigan).
Supported by¶
DevNotes that support this page include:
- Hwang, S.-W., Li, Y., Green, A. A., & Liu, A. P. (2025). pH-Responsive Synthetic Cells for Programmable in Situ Protein Synthesis and Release. 10.1101/2025.11.16.688650